- Home
- James Greer
Artificial Light Page 24
Artificial Light Read online
Page 24
Notebook Twenty
In the last minute before I killed Kurt, he told me something. It happened this way: After helping him tie off with an old brown leather belt, and watching him inject a syringe full of high-grade heroin into his right forearm, he lay down on the floor by the bookshelves in the corner of the room farthest from the windows. We had propped up some pillows to rest his head, and to allow for the proper angle for me to shoot him. He handed me the gun, a Sig Sauer P226 pistol with one 9mm bullet in its chamber—he explained to me, slowly, the way a person explains things when the rush of heroin hits his bloodstream—and it remained for me only to cock the hammer, once, for single-action fire, and place the muzzle of the gun at a slight angle against his left temple. He explained how I was to hold the gun, how to prepare for the kick of the shot, what to do with the casing, which would be automatically expelled by the silver-ellipsoid extractor, how to wipe the fingerprints, place the gun in his cold dead hand, disappear. Then he wanted to say something more, and gestured for me to lean close as he was no longer capable of speaking above a hoarse whisper.
Tears slicked my face. Kurt reached up to dry them with the frayed cuff of his shirt, smiling. “I suppose you want to know why?” he whispered.
I felt immediately stupid, because it had never occurred to me to ask why. I assumed, again stupidly, that the reason had something to do with the pressures Kurt had faced from the outside world as a result of his sudden success, or what I understood to be his sudden success. Or the natural, and naturally intolerable, depression he had faced his whole life, as he told us, even before the fame and the fortune, made worse by his hapless attempts at self-medication, especially heroin, and thence heroin addiction, which in my own second-hand experience seems enough itself to make someone want to shuffle off. I had not asked because it would have been—and I know this is stupid, because I felt stupid then and I still feel stupid—somehow impolite. A person has his reasons. He asked me a favor, and I agreed.
But I was wrong in my assumptions. Because when Kurt told me the real reason, I was stunned. I was stunned and I am still stunned, which is why all these words have been pouring out of me in the days since his death. He told me a secret, Kurt did. A real secret. Maybe the only Real Secret. And as his last dying wish (apart from asking me to kill him, which as I said was more of a favor than a wish), he made me promise not to tell the secret.
I have not kept that promise. That’s the part that breaks my heart. A man asks you, his last dying wish, to keep a secret, you keep that goddamn secret. You keep it if it kills you.
But I couldn’t, because the secret did not kill me but it changed me. In that instant, the moment those words entered my brain like a 9mm bullet fired from a Sig Sauer P226 pistol at close range, I became Fiat Lux. I broke the shell of myself and entered into the realm of potential made manifest. Fiat Lux is not my real name. You will have guessed that.
So my reasons for breaking my promise to Kurt are straightforward: The girl who made that promise no longer exists, at least in the commonly understood sense of the word, and so I can’t break a promise that I, myself, Fiat Lux, did not actually make. You will probably judge this an absurd rationalization, even a lie, but if you knew the secret you would perhaps understand.
And you will know the secret. I have buried it in these pages, and buried it well, I think, but everything buried comes to light, if not immediately then so much the better. In this way, I tell myself, I’ve remained true to the spirit if not the letter of my promise, notwithstanding my cheesy promise loophole. In order effectively to bury Kurt’s secret herein, I’ve had to do some fairly difficult things: because I know nothing about the past. Because I know nothing about music. Because I know nothing about the future. Because I know nothing about two doomed characters who recognize their love for each other too late. (And lest you think that I have given too much away by telling you what I’ve done, a warning: You have not guessed the secret. If you think you have, then you certainly have not. The only way to know if you have guessed the secret—and here I really am giving too much away—would be to ask me. When you have understood correctly, you will understand how.)
After he told me, I took a moment to regroup. The world inside me was still reeling, trying to gather enough force to escape, to complete the change that Kurt’s secret had set in motion. I looked at the gun in my hand, and suddenly didn’t understand why I had a gun in my hand. I didn’t even understand it as a gun: I didn’t know what the thing was, or what I was supposed to do.
So I asked. “What is this?”
“Jawbone of an ass,” replied Kurt. “Smite me.”
My mother’s death continues to dog me. When you watch someone die, in stages, over a long period of time, you lose to some extent the ability to fear the event itself. A prolonged stint of bedside attending, bedsore bandaging, and bedpan changing will produce, eventually, an immunity to the final effects of death’s long-awaited appearance. Admittedly, violent, sudden death was something unknown to me in personal experience, although my father died in this way; but I was not there, I didn’t see what happened, and the brutal truth of his passing was kept from me for some years out of an understandable delicacy with regard to its possible effect on a young girl. But I did not see the difference between killing Kurt and watching my mother die: I saw instead the similarities. In both cases, I saw a human being in the grip of great suffering, at the end of a process of dying whose result could only be the cessation of pain. If I’d had a gun, or some other effective means of dispatch, and the sense, or had my mother asked me, I would—in retrospect, mind you, the thought never occurred to me at the time—without hesitation have hastened her end.
I placed the gun at the instructed angle, pressing lightly against Kurt’s temple. For some reason, I gently pushed a few stray strands of his greasy blond hair from the side of his head, tucked them behind his ear, as if the presence of these frail fronds might deflect the path of the bullet. We still say descent of night or nightfall. Thus in Homer: “Bright light of sun sank into the ocean, dragging down dark night.” Thus in Cato: “se nox praecipitat.” In the Book of the Dead, the red of sunset is the blood of Ra as he hastens to his suicide. To the poetic vision of early seers, the crimson West seemed ensanguined by some great massacre that had been perpetrated there. Hommel and Hilprecht (Die Insel der Seligen) have identified the gateway through which Gilgamesh (the bright Day-God) had to make his way to the West: the “Twin Peaks” of Central Arabia, the mountain of Sunset, now called Jebel Shammar. Two peaks, Aga and Salama, stand apart confronting each other, and form a natural portal. Egyptian representation of the sky as a great dome resting on two pillars, Shu and Tefnut. Tum-Ra, the evening sun, sets in darkness; he seizes these pillars and overthrows the sky. Aborigines of Australia believe the sky to be supported on props which keep it from falling. (This is an almost perfectly universal idea.) “It is these pillars the blinded giant (the dim-grown sun of evening) withdraws when he brings night down upon the world in the final catastrophe which involves his own death.” (Smythe-Palmer). Samson, bound between the twin pillars of the temple at Gaza—enraged, blinded (in actual fact blind only in one eye, although this is not recorded in the Bible but can be demonstrated through myth-redaction—the sun in one eye, the moon in the other)—shakes the pillars until the roof collapses, killing himself and far more Philistines, in death, than he had ever killed in life. Likewise the Sun God, (Shamesh, Shu, Gilgamesh, etc.), blinded and enfeebled by the encroaching dusk, pulls down the twin towers of the firmament at day’s end, and sky collapses into night.
Matador manhandles minotaur. By the window—sycamore, sycamore, rock. Praise be to God for addled things, for piebald sodden brains dappled with alcoholic insight. Oh, and the smooth circuitous way she lies. Incunabula of moot resistance. You cant untangle threads of mein herr, nor plum the death of sea’s own sad light.
Broken day, sepia tint. Last falling down myth: sacrament of marriage. Linnaeus caroling through Lapland�
�reindeers’ balls, hags’ pudenda. Sun sags to bed, world-weary, unfortunate. Moves on the face of the waters. Paraclete.
Make lines of light where no face has ever peered, seen, sunk, drooled, wept, wiping tears with hand maid of light, lettered in green ink, shining, like raggened blankets of green rushes, burny, reflex of scratch of optics of glasses.
His last girlfriend, in the meaning you mean in the meaning: even, mourn, day flouring, on her face and over the dour, everywhour. Travel swell.
O shore.
O lift us all, hymn.
Philomel. Singer in the eye. Ten vocabularies scumbled inner hello, stippled wit black inc. Octagonal runs to seed or runny plum. Inappropriate name, muser. Inaccurately dressed. Missed her. Moralist anger, more and less, strung along the hinge of reason, blossoms bright in rage. Time sit. Truth ache. Come put her, thousand calculations, face launched, rite in the center.
High and holy hill. On it grows them guts and morning glory.
King Ibn, thin. Littoral translation.
Winter harrows the land, harrowing winds dump hurricane sugar on highlands like croppings of snow. O the beauty and the bees. Nutting ear.
Again, aging. Trump.
Ace.
Aces.
Access.
Ate.
In the Latin, lads, its ove for egg, in Eytie dove for where, in Angleterre Dover for endall beall. Lovers leap. Lovers leap, lads, and you shall leap.
You shall leap.
Through trope and metaphor, the Revelator, immortal scribe of Spirit and of a true idealism, furnishes the mirror in which mortals may see their own image—if the mirror has a deliberate flaw, is it God’s patience or subtlety of evil? Take art, dear sufferer, for this reality of being will surely appear sometime. Not yet elevatored to deific apprehension through spiritual transfiguration. This city of God has no need of sun or satellite, for Love is the light of it, and divine Mind is its own interpreter. All must walk in its light.
I pulled the trigger. Hwæt! … Beowulf wæs breme (blæd wide sprang). Amore abundas, Antipho. Aber den Einsamen hüll in deine Goldwolken! For all to sicker, as cold engendreth hail, a liquorish tongue must have a liquorish tail. Illud iam voce extremo peto: Daybreak dry me. Hell of later. Zero sum. Per me si va ne la città dolente, per me si va ne l’etterno dolore, per me si va tra la perduta gente. The pale of settlement. Things that burn (list). Ancient Rites of the Condoling Council. At the wood’s edge: Niyawenhkowa kady nonwa onenh skennenjy thadesarhadiya-konh. The Doctrine of Eternal Life, as though ha Unas an sem-nek as met-th sem-nek anxet hems her xent Ausar. The Niche for Lights (Mishkat al-Anwar). Peut-être l’immobilité des choses autour de nous leur est-elle imposée par notre certitude que sont elles et non pas d’autres, par l’immobilité de notre pensée en face d’elles. Bismi Allahi alrrahmani alrraheemi. First line of Chromosome One of the human genome: GATCA ATGAGGTGGACACCAGAGGCGGGGACTTGTAAATA ACACTGGGCTGTAGGAGTGA. Bodhichitta. Engine of combustion: life. Correspondence. Repetition. Duplication. The light that draws the flower draws you, too.
Notebook Twenty-one
The rain, blackly bursting from the predawn sky, gathered force and came in slanting gusts through the windows of his station wagon; Michael Goodlife had no choice but to roll them up. No matter: He was almost home. The left arm of his midnight-blue jacket was drenched. He wrung the material of the jacket with his right hand, and rivulets of cold water ran down the underside of his arm to the floor, gathering in the margins of the floorboard and disappearing down a tennis-ball-sized hole near the clutch that had been patched with duct tape but nevertheless admitted to the interior of the car a quantity of carbon monoxide, which, it was later determined, was what killed him. The inside of the windshield acquired a thin patina of condensation, in which Michael rubbed a dark hemisphere with his dry right sleeve. His headlights groped gingerly the seal-slick street, and the steady thrum of his wipers provoked from his pleasantly drink-fogged brain an answering hum, the threads of a half-remembered song Michael could not immediately place.
He puttered grayly in his old car down Main, through the uninhabited regions of downtown, past empty and disused storefronts, abandoned churches, the shell of a long-gone gas station. The steps of the courthouse at 3rd Street, usually peopled even at that early hour with homeless drunks, crack enthusiasts, and whores, were sullenly vacant, glassy-eyed and strangely swollen with rain, as Michael slowed to a stop at a purposeless traffic light. No other cars disturbed the watery night. The light winked green, reflected diffusely on the glossy steel of his wet hood, and he accelerated toward the narrow bridge over the Miami River, braking only as he reached its verge as a precaution against the cops who were fond of hiding in the penumbra of the ornate stone portal to catch careless drivers.
Tonight he was lucky: no cops. His car susurrated over the bridge, and he noticed with a small thrill of delight that the traffic lights on the other side wore a nimbus of green as far as he could see, all the way up North Main Street. All the way home. “Permanent green light,” Michael mused, and here time abruptly split. His car seemed all at once to lose power, and glided to a halt just outside McCabe’s.
Michael popped the hood and got out of the car. His limbs felt oddly light, and for a moment he had the sensation of floating rather than walking as he moved to the front of the car. He shook his head, its dark tangle of curls dimly limned in the reddish gleam emanating from somewhere inside McCabe’s. The rain had stopped, as suddenly as it started. Michael looked up curiously at the sky, where strong winds had already torn a ragged hole in the web of storm clouds, and he could see a small clot of glimmering stars. Something in the aspect of those stars seemed to hold his attention; he craned his head to one side as if listening, and his features were bunched in an effort of concentration. At length his brow settled, and he gave at the same time a quick smile and a nod of recognition.
Mary closed the door behind her and sighed. Was it a sigh of satisfaction or relief, or maybe just a sigh of being tired. She kicked off her left shoe, used the heel of her foot to pry off the right. Advancing toward the bathroom, she stepped out of her skirt, and, reaching the bathroom door, flicked the light switch and in one smooth movement slipped her shirt over her head.
That I could run a bath. That I should run a bath. Mary unhooked her bra and threw it on the tiles of the floor next to the sink. She turned the taps and cupped her hands under the flow of water. Lowering her face to her hands, she noticed with some surprise that her cheeks were already glossy with tears.
Crying again, and for what reason on earth? she thought. Makes no sense. The feeling swells inside like a tumor when I picture his face, when I watch his hands enfolding a beer bottle wet with dew, the way he talked to Kurt at Albion, so sweet, so entirely unguarded. Because he showed a capacity for kindness I have not seen in so long, and thought gone forever. Toward me anyhow. Something inside gives way—or the spigot wrenches on, is that right?—then the waterworks, within me and without me. For those brief moments of our conversation I turned to liquid. I am deliquescent.
She braced her arms on either side of the sink and looked in the mirror. A bright girl. Bright pink and scrubbed and hair that almost glows. He came behind me now, I’d let him, I’d say yes to anything—which was never the point. Only too late do you learn the right time and the right time.
She stood and turned, reaching for the matted and musky olive-green towel on the rack behind. Still wet from evening bath, she thought, burying her face in its cotton furrows.
Mary Valentine turned off the bathroom light and walked with care the ten feet between the door and her mattress, an obstacle course in the dark and drunk. Having achieved the distance without mishap, she sank to her knees and crawled on top of the sheets.
Lying on her back and staring into the formless pitch that at some invisible spot was bounded by the ceiling. If nothing else the weight of unresolved emotion had lifted, or shifted, perceptibly. Mary spread her arms wide on the thin mattress. Her body seemed to r
ecede, allowing some important part to rise, or float, even to fly, slowly and she thought naturally, perfectly in accord with nature, toward the invisibly visible ceiling, which after all did not exist, because there were no more ceilings, no more boundaries, strings, attachments, ties, chains, strands, webs, nothing to hold her here anymore. The last knowt cut. Mary giggled, then her giggles turned to sobs, and her tears like drops of black rain fell from a great height onto the sheets of her bed.
She turned on her side and stared at the dark square of window on the near wall. He will nevermore come into my bed, come crawling on his fours and slip under the sheet, brush my face with his lips. A hundred times since then I have disported with young men in pleasant grooves, but never in this bed, never under this sheet. Why? I’ll tell you why, Mary Valentine, because when you leave the darkness behind, what’s left is not necessarily light.
Several blocks down the road, at the North Main Street house the two shared, Joe Smallman, Michael’s roommate, lay on his bed drinking the last of a large glass of vodka and Tang, a cocktail Michael had dubbed the “John Glenn” in honor of their home state’s favorite astronaut. Joe was brooding over Amanda Early, as he usually did at this hour, in the brief lacuna before surrendering to sleep. He sighed resignedly, and doubled again the lower part of his pillow under his head, despite which it again stubbornly slipped out and flattened against the bed. If she had wanted to keep the baby I would have married her, he thought. Or not married, but still. Even if only that one time, though, on the porch, as the sun set, I will have that always, I will hold on to that moment until I die. But she wants to get rid of the kid, makes sense, too young for the responsibility. Even so I would stick with her. Even so I would, yes, say the word, love her. But whenever she’s around I affect a listless nonchalance. An instinctive defense posture. There is something wrong with me that no drug can cure.

Artificial Light
The Failure: A Novel
The Failure